I Talk Too Much

I Quote Too Much

Choose life. Choose a job. Choose a career. Choose a family. Choose a fucking big television, Choose washing machines, cars, compact disc players, and electrical tin openers. Choose good health, low cholesterol, and dental insurance. Choose fixed- interest mortgage repayments. Choose a starter home. Choose your friends. Choose leisure wear and matching luggage. Choose a three piece suite on hire purchase in a range of fucking fabrics. Choose DIY and wondering who you are on a Sunday morning. Choose sitting on that couch watching mind-numbing sprit- crushing game shows, stuffing fucking junk food into your mouth. Choose rotting away at the end of it all, pishing you last in a miserable home, nothing more than an embarrassment to the selfish, fucked-up brats you have spawned to replace yourself.Choose your future. Choose life... But why would I want to do a thing like that?

No power in the 'verse can stop me!" -River Tam
"Also, I can kill you with my brain." -River Tam
"Played with Kaylee. Sun came out, and I walked on my feet and heard with my ears. I function like I'm a girl.
      I hate it because I know it'll go away. The sun goes dark and chaos has come again. Bits. Fluids. What am I?!" -River Tam
"Salary is no object; I want only enough to keep body and soul apart." -Dorothy Parker
"The cure for boredom is curiosity. There is no cure for curiosity." -Dorothy Parker
"The poet, too, is not nearly so concerned with describing facts as with creating images." -Neils Bhor
"I have nothing to say, and I am saying it, and that is poetry." -John Cage
"Poetry is just the evidence of life. If your life is buring well, poetry is just the ash." -Leonard Cohen
"Wit has truth in it; wisecracking is simply calisthenics with words." -Dorothy Parker
"Genuine poetry can communicate before it is understood." -Thomas Sterns Eliot
"Poetry is when an emotion has found its thought and the thought has found words." -Robert Frost
"Everywhere I go, I find a poet has been there before me." -Sigmund Freud
"Perhaps no person can be a poet, or can even enjoy poetry, without a certain unsoundness of mind." -Thomas Babington Macaulay
"Poetry is the rhytmical creation of beauty in words." -Edgar Allan Poe
"I have great faith in fools;self-confidence my friends call it." -Edgar Allan Poe
"Poetry is an echo, asking a shadow to dance." -Carl Sandburg
"A poet can survive everything but a misprint." -Oscar Wilde
"Poetry is a mirror which makes beautiful that which is distorted." -Percy Bysshe Shelley
"A poem is never finished, only abandoned." -Paul Valery
"The unknown defines our existence." -Benjamin Sisko, "Emissary"
"They are not laughing with you, Lal, they are laughing at you. -Data Soong, Episode 64, ST:TNG, "The Offspring"
"It takes courage to look inside yourself and even more courage to write it for other people to see."
      -Benjamin Sisko, "Nor Battle to the Strong"
"You cannot destroy an idea." -Benny Russell (Benjamin Sisko) "Far Beyond the Stars"
"Moogie, take me out of the oven! I'm done!" -Quark, "Shadows and Symbols"
"These prounouns are going to drive me crazy!" -Ezri Dax, "After Image"
"That's the thing about faith. If you don't have it, you can't understand it,
      and if you do, no explanation is necessary." Kira Nerys, "Acession"
"You are the dreamer, and the dream." -The Preacher (Jacob Sisko) "Far Beyond the Stars
"Benjamin, are you getting stranger, or is my memory playing tricks on me?" -Ezri Dax, "Shadows and Symbols" "We must anticipate, and not make the same mistake once." -Jean-Luc Picard, "Time Squared"
"I believe in coincidences. Coincidences happen every, but I don't trust coincidences." -Elim Garak, "Cardassians"
"Data, things are only impossible until they're not." -Jean-Luc Picard, "When the Bough Breaks"
"I can't sacrifice the present waiting for a future that may never happen." -Chakotay, "Resolutions"
"You think in such three-dimensional terms. How small you've become." -Borg Queen, "First Contact"
"We used to be just like you: flawed, weak... organic." -Borg Queen, "First Contact"
"Organic minds are such fragile things." -Borg Queen, "First Contact"
"You imply disparity where none exists." -Borg Queen, "First Contact"
"A macrophage is a phagocytic cell on a vision quest." -Neil Marshall, 1998
"If you've got one nematode, you've got a pet!" -Neil Marshall, 1998
"You can forget that two second rule crap. It takes bacteria a whole 20 minutes to divide!" -Jamie Deneris
"These aren't the droids you're looking for. Move along." -Storm Trooper at Moss Isley port, "Star Wars IV, A New Hope"
"Why don't you go outside and play hide and go fuck yourself?" -American English Idiom
"Do they speak English in What?" -Jules Winnfield
"I'm thinking of the immortal words of Socrates: 'I drank what?'" -Chris Knight, "Real Genius
"Ya know, half of these gook whores are serving officers in the Viet Cong; the other half have got T.B.
      Be sure you only fuck the ones that cough." -Joker, "Full Metal Jacket
"Stop saying, 'Don't quote me,' because nobody quotes you.
      You probably haven't said a thing worth saying." -KMFDM, "Dogma"
"I'm doing a hundred on the highway, so if you do the speed limit, you best get the fuck out of my way." -Ludacris
"Fuck no, Hell, you're white, you'll never be like us." -Hardcore Asian Thugs, "Got Rice"
"Still crys at a good film. Still kisses with saliva." -Thom York
"There's no place like 127.0.0.1" -Who Knows?
"I don't really miss God, but I sure do miss Santa Claus." -Courtney Love
"Even when you were throwing up, I knew you cared." -Dill, "The Crying Game"
"Ever pick your teeth up off the floor with broken fingers?" -Jimmy, "The Crying Game"
"If there were reasons for these miseries, I could bind my sorrows." -Titus Andronicus
"Pray to the devils. The gods have abandoned us." -Aaron, the Moor
[Lavina signs eyes to mouth] "She says she drinks no other drink than tears. - Titus Andronicus (on Lavinia Andronicus)
"Her life was sad and beast like." - Lucius Andronicus
"You're a poet and didn't know it." -Every asshole who can recognize a rhyme
Donnie Darko: Why are you wearing that stupid bunny suit?
      Frank: Why are you wearing that stupid man suit? -"Donnie Darko"
"It's a Kafka high. You feel like a bug." -Joan Lee, "Naked Lunch"
"I think you made me throw up a little." -Happy Bunnies
"I had my soul removed to make room for all this sarcasm." -Some Sticker
"Manic depression is a frustrating mess." -Jimmi Hendrix
..."they are not towers but giants. They stand in the well from the navel down;
      and stationed round its bank they mount guard on the final pit of Hell."
                                    -Dante Alighieri, The Inferno, Canto 31
"If you've got crab lice in your eyebrows, you probably deserve them." -Candace Alicia Gee
FUCK THE POPE! -Every Drunk Scotsman at Some Point
"'Peace.' I hate the word; as I hate hell, all Montagues, and... thee." -Tybalt, Prince of Cats, "Romeo and Juliet, William the Baud
"Sometimes I'm dreaming." -The Cure
"She's a predator posing as a house pet." -Tyler Durden
"Losing all hope is freedom." -Tyler Durden
"Only users lose drugs." -Nancy Ragan after a huge bong rip
"Idle hands get in the way of the devil's work." -Basil Fawlty
German: We didn't start it! You started it!
      Basil Fawlty: You invaded Poland!
Vince: Say what it means, okay?
      Keiko Nishi: ...I may not be for long. If you do not pay the sum of one million dollars,
      you will never see me alive again. These men mean businesses..."
      WHO WROTE THIS?! -"The Big Hit"
"что вокруг нас - это ветер
      что падает вниз - это пепел." -Ёлка, "Город Обмана"
"Did you have a good world when you died? Enough to base a movie on? -James Douglass Morrison
"Anyone want to waste some time?" -Marion Silver, "Requiem for a Dream
"Holy shit, it's the Pope!" Janine Garaffalo's Character, "Dogma"

Mini-MacKinnon Section. Mostly Duncan Y. MacKinnon and Self (DYM= x(d)x, D2, D^2, et cetera)

Website: A Pupillary Distance of 52 is closer than normal.
      Please check again and confirm there has been no mistake.
      Duncan Y. MacKinnon: If your eyes were any closer together, you'd be a cyclops!
"I could really go for some multi-codon frame-shift mutations right about now." -Duncan Y. MacKinnon
"Look in my recycle bin. It's already back in the house!" -Duncan W. MacKinnon
"Scratch that." -The MacKinnon Family
Duncan Y. MacKinnon: It's the Van Goh mouse!
      Me: Let's get a sack! Where's the mental ward?!
"I dubbah yoh odah!" -Duncan Y. MacKinnon (Courtesy of Mon Kok Dim Sum Lady)
Self: What's your favorite genomic sequence?
      Duncan Y. Mackinnon: CCCCCCCCCCTATATATATATATATA
"Eliza Dushku's introns are TATATATATATATATATATAT." -Self (To Duncan Y. Mackinnon)
"I'd like to go see Eliza Dushku do sign language. -Self to Duncan Y. Mackinnon
"Pogue MaPhone." -Duncan Y. Mackinnon and Self
"NEON TETRAS!" -Duncan Y. MacKinnon (Courtesy of Self)
"UUUUUGGGGGHHHHH! Put the Pinto back in the garage!" -Duncan Y. Mackinnon (Courtesy of Roman Dirge)
"DUCI: Driving Under Chinese Influence." -Duncan Y. Mackinnon
"Gunpowder Headache!" -Duncan Y. MacKinnon and Self
"DUNCAN is not the teacher, he WILL NOT BE GRADING YOUR TESTS, YOU'RE GOING TO HAVE TO ASK ME THE QUESTION" -Duncan Y. MacKinnon's Idiot Math Teacher 7th Grade
      The question was "Can we us 3.14 for pi?", I said "ya", next time I'm thinking of answering "You could, but 3.14159265358979323846264338327 would be a little more precise."
"Don't be time-stealers!" -Same Dumbass
"What's taking them so long, are they making the clothes first and then buying them?" -Self to x(d)x about his parent's taking so long to come out of a store.

End x(d)x Section. Begin Friend and Self Quote Section

"I want to go to Fry's to just look at the stuff." -Andrew Taylor Scott
I don't use much sarcasm. -Andrew Taylor Scott
      Yeah... Neither do I! -Self
"Google love you like a fat kid love cake." -X
"Thank you for calling LinuxCare. Sifry? No. He's out eating a stick of butter." Donald B. Marti, 1999
"William Gibson has a blog?! There goes my life! -Kieran Hervold
Pete's Coffe Worker: Did you know 'gullable' is not in the dictionary?
      Kieran John Hervold: Really?
"She's entirely too vain to ever accomplish anything significant." -Jen Hsu
"I want to start a radio station. Radio 'WTF?'" -Richard Childers
"I don't get protestants. I mean, God has a sense of humor, why don't you?
      I mean, He made retards- He's gotta be laughing at that shit."
      -Abraham O. Mendoza, 2005
"Hit 'D' and move on." -Robert D. Malda, Jr., 1998
"Mae Ling, you have a preternatural talent for getting yourself into trouble. [LMAO]" -Eric Steven Raymond
You have two rats... and a TRACK BALL?! -KSI, 1996
"I know a great many things which could be considered of some importance, however, perpetually vomiting volumes of nothing,
      I will more than likely never truly be heard. I'll be 'The Girl Who Cried 'Heron'"-Self
"You are on my nerves like Mycobacterium leprae!" -Self
"If I ever find Jesus, there's going to be one hell of a ransom! -Self
"Tomorrow, today will be yesterday." -Self
"No blood ever need tie a family. No thing ever need come before one." -Self
"Always choose the side which would never make you choose." -Self
"The proof lies within the proven." -Self
"Love makes whole that which was shattered by love." -Self
"Who died and made you the King of Qin?" -Self
"Treat a man as if he were the Emperor of Qin, and in kind,
      you will become a subject of He Who Reigns All Under Heaven.
"To thine own self, know shit." -Self
"Making mistakes just makes us people. Wow. That really makes me people! -Self
"You got a leg hanging of that 21st? -Self
      Explanation
"Quit shakin' my Etch-a-Sketch!" -Self
"We forked that process! We forked that process!" -Self
"Neil Fucking Marshall, you did Syphillis without ME?!" -Self ("The Ecology of Infectious Diseases", 1998)
"I quote too much." -Self
"I'm not stopping. Those sirens are for people to get out of my way." -Self
"Just because I'm paranoid doesn't mean they're not out to... What was that?" -Self
"Curiousity killed the cat... Or didn't... Or did... Or didn't..." -Self
"If everyone else would take my sedatives, I wouldn't have to!" -Self (Back when I used to have to take sedatives)
"Glass ceilings are made of Micro$oft Windoze." -Self
"Give me the Add-Mixes!"- Self
"Here's a roll of quarters. Go get yourself a spine." -Self (probably had to be there...)
"Kieran, go sleep on the couch. You smell like someone threw up potpouri all over you." -Self (He'd been drinking Southern Comfort)
"Do you pop out of a clock every half hour?" -Self
"Sorry for that whole sin/cos ride I just took you on there." -Self
"If you're my friend, I'll do anything for you. If you're my enemy, I'll do anything to you." -Self
"I've got to add that to my quotes page." -Self
"You've got to add 'I've got to add that to my quotes page' to your quotes page. It'll be recursive." -Andrew Taylor Scott
"I scream, You scream, We all scream when we see ice cream." -Self (Anorexic's "Ice Cream Song")
"What doesn't kill me makes me a bigger bitch." -Self
"Sleep is something I can only dream of. Wake me when it's over." -Self
"Mistakes make the greatest teachers." -Self
"There's something funky in Hamlet County." -Self
"Pete and Repeat were in a boat. Pete fell out. I beat the shit out of repeat." -Self
"If you're not laughing, you're crying. I had rather be laughing." -Self
"If that thing doesn't have a brain sophisticated enough to make it hold a constant body temperature, it's not smart enough to love you.
      No, it's not nuzzling you, dumbass. You're warm." -Self (about reptiles as pets.)
Self: I don't think I'm brave enough to ever date a guy who runs an unstable kernel.
      Seth David Schoen: Can I quote you on that?
      (On Kernel Release 2.1.19... How long ago was that?!)
"SHUT UP, MAE LING!" -Self (Because all of you are thinking it...)
      ...not like I don't constantly think that...
"You put milk in your toilet bowl? Oooh! Prada!" -Self (Sleep deprivation will do that.)
"I just entered my IP address as my password... Huh...
      If I were any further out there, I might be able to tell you what happens when the universe stops expanding.
"No regrets and never fear." -Self, 1996 (to William Martin)
"BIG RED: The Peoples' Gum" -Self
"I don't know how long I was napping on that highway." -Self
"Don't eat shrimp for the next few years because it's all full of Thai people." -Self
"...Unless you like Thai food..." -Richard Childers
"Free speech online: Because reading is Not autonomic." -Self
"You have reached 415.731.6639. Leave your name and number, and I'll return your call as soon as I recover from this ennui." -Self
"Hopping back onto the Moebius strip we were crusing... What were we talking about a minute ago?" -Self
Words are gods unto themselves. They cannot be destroyed once written.
      When spoken, they evaporate and return to the ether- leaving all meaning floating in nothingness.
      When written, they are eternal." -Self
"oofuckingoops." -Self
"All generalisations are false." -Unknown, quoted by Self
"You've got to have a plan B for your plan B and a plan B for that plan B so that you always have something for which to look forward and never fail." -Self
"Thanks for Michael, I am the list!" -Self

Buffyverse

"Hey! Party in my eye socket and everyone's invited!
      Sometimes I shouldn't use words." -Alexander Lavelle Harris
"These flowers are all wrong! I can't abide them!" -Drusilla
"Stop whatever it is you're doing. You smell like Fruit Rollups." -Rupert Giles
"Come on- just getting wood for the violence here!" -Evil Willow
Buffy Anne Summers: What are you doing here? Five-Words-Or-Less.
      William the Bloody: Out-For-A-Walk-...BITCH.
"That'll put marzipan in your pie plate, bingo!" -Buffybot
"Willow! nice dress! Good to know you've see a Softer Side of Sears." -Cordelia Chase
"I'm the Pushy Queen of Slut Town!" -Dawn Summers
[Smashes Daltons Glasses] Make a wish. I'm going to blow out the candles. [Motions to put both fingers through his eyes.] -Drusilla Willow Rosenberg: So, will you help me?
      Anyanka Christina Emanuelle Jenkins: Is it difficult or time consuming?
"I'm on my side. That's enough." -Faith
"Safety words are for wusses." -Faith
"What will your mummy sing when they find your body?" -Drusilla
"Preaching to the horse's mouth." -Harmony Kendall

	'Cuz I look around at this world you're so eager to be a part
	of, and all I see is six billion lunatics looking for the
	fastest train out. Who's not crazy? Look around: Everyone's
	drinking, smoking, shooting up... shooting each other.... or
	just plain screwing their brains out 'cause they don't want
	'em anymore. I'm crazy? Honey, I'm the original one-eyed
	chicklet in the Kingdom of the Blind. 'Cuz at least I admit
	the world makes me nuts."
						-Glorificus

Charles Gunn: What happened to you, man?
      Wesley Windham Price: My throat got cut and all my friends abandoned me.
"All I am is what I am. I lived 7 lives at once. I was power and the ecstasy of death.
      I was god to a god. Now ...I'm trapped ...on a roof...
      Just one roof, in this time and this place..." -Illyria, Godking of the Primordium
"I walked worlds of smoke and half-truths, intangible. Worlds of torment
      and of unnamable beauty. Opaline towers as high as small moons.
      Glaciers that rippled with insensate lust. And one world with nothing but shrimp.
      I tired of that one quickly." -Illyria, Godking of the Primordium
"That's the reason I love this country. You make a good product,
      and the people will come to you. Of course, a lot of them are gonna die,
      but that's the other reason I love this country." -Mayor Wilkins
Cordelia Chase: Things just keep getting weirder and weirder.
      Winnifred Burkle: They really are. [whispers] Have you got any weed?
"Funny thing about black and white -- you mix it together and you get gray.
      And it doesn't matter how much white you try and put back in,
      you're never gonna get anything but gray." -Lilah Morgan
Angel: The enemy of my enemy...
      Lilah Morgan: ...Can kiss my ass, too.
"God may not want you, but I-STILL-DO." -Darla
"Dude, hockey is the whitest sport known to man." -Charles Gunn
"Damn, this is a lot harder than it looks on Batman!" -Charles Gunn
"I mock you with my monkey pants." -Daniel Osbourne (Oz)
"Repeat until insane." -Buffy Anne Summers
"My friends. They were supposed to be my light at the end of the tunnel.
      Guess they were a train." -Buffy Anne Summers
"5x5" -Faith
"...it's just so much fun ruining his life. He's like family." -Darla
"News from the file marked 'Duh'" -Alexander LaVelle Harris
"I hate my free will!" -Andrew, Tucker's Brother
Alexander LaVelle Harris: I'm sick of this crap. I'm sick of being the guy who eats insects
      and gets the funny syphilis. As of this moment, it's over. I'm finished being everybody's butt-monkey!
      Buffy Anne Summers: Check. No more butt-monkey.
Warren Mears: W-what the hell is that?
      Andrew Wells: Death Star, dude! Wicked, huh?
      Jonathan Levinson: (scornfully) Thermal exhaust port's above the main port, numbnuts.
      Andrew Wells: For your information, I'm using the Empire's revised designs from Return of the Jedi.
      Jonathan Levinson: That's a flawed design!
"Warren's the boss. He's Picard, you're Deanna Troi. Get used to the feeling, Betazoid." -Andrew Wells
"Think your little witch buddy's gonna stop with us? You saw her! She's a truck-driving magic mama!
      And we've got maybe seconds before Darth Rosenberg grinds everybody into Jawa burgers.
      And not one of you bunch has the midi-clorians to stop her." -Andrew Wells
"I hate failure when there's no one else to blame it on." -Lindsey McDonald
"I've been all wrongheaded about this. Weeping, crawling, blaming everybody else. I want Dru back,
      I've just gotta be the man I was, the man she loved. I'm gonna do what I shoulda done in the first place:
      I'll find her, wherever she is, tie her up, torture her until she likes me again. Love's a funny thing." -William the Bloody
William the Bloody (Spike) on a roof, looking down on Angel: (imitating Woman): How can I thank you, you mysterious,
      black-clad hunk of a night thing? (imitating Angel) No need, little lady, your tears of gratitude are enough
      for me. You see, I was once a badass vampire, but love and a pesky curse defanged me.
      Now I'm just a big, fluffy puppy with bad teeth. (Rachel steps closer to Angel, and Angel steps back,
      warding her off with his hands) He Continues: No, not the hair! Never the hair! (high voice) But there
      must be someway I can show my appreciation. (low voice) No, helping those in need's my job, and working
      up a load of sexual tension, and prancing away like a magnificent poof is truly thanks enough! (high voice)
      I understand. I have a nephew who is gay, so... (low voice) Say no more. Evil's still afoot! And I'm
      almost out of that Nancy-boy hair gel I like so much. Quickly, to the Angel-mobile, away!
                                        -from Angel, the Series (Spike Crossover)
"Dylan talked copiously, then stopped. 'Somebody's boring me,' he said, 'I think it's me.'" -Dylan Thomas
"Bored now." -Vampire Willow (season 3), Evil Willow (season 6)